To get on Orchestra you want to connect via ssh, and to turn X11 forwarding on. Turning X11 forwarding will let the Orchestra machines open windows on your local machine, which is useful for looking at the data.
Connect to Orchestra using X11 forwarding:
ssh -X your_user_name@orchestra.med.harvard.edu
Orchestra is set up with separate login nodes and compute nodes. You don't want to be doing any work on the login node, as that is set aside for doing non computationally intensive tasks and running code on there will make Orchestra slow for everybody. Here is how to connect to a compute node in interactive mode, meaning you can type commands:
bsub -q interactive bash
Do that and you're ready to roll. You should see that you are now connected to a node
named by an instrument like clarinet
.
The raw data we will be using for this part of the workshop lives here:
/groups/pklab/scw2014/ES.MEF/subset
Those files are a 1000 reads from ~ 100 samples from a single-cell RNA-seq experiment looking at mouse embryonic fibroblasts (MEF) and embryonic stem (ES) cells. These are files you might get from your sequencing core after you send them off for sequencing. We'll be taking a subset of those files, looking at them to make sure they are of good quality, aligning them to the mouse genome and producing a table of number of reads aligning to each gene for each sample. The counts table will be the starting point for the more interesting downstream analyses.
We will be using programs that are installed here:
/opt/bcbio/local/bin/
The output of typing which fastqc
at your prompt should be
/opt/bcbio/local/bin/fastqc
. If it isn't flag someone down and
we will fix it.
We're going to do this like a cooking show, we'll use those ES.MEF files as a small example just to make sure everything is working, then we'll look at pre-computed results on a full set of samples.
The first thing we will do is copy the small test data over into your own directory.
mkdir ~/workshop
cd ~/workshop
cp -r /groups/pklab/scw2014/ES.MEF/subset .
These commands mean:
With the start of any data analysis it is important to poke around at your data to see where the warts are. We are expecting single-cell datasets to be extra messy; we should be expecting failures in preparing the libraries, failures in adequately capturing the transcriptome of the cell, libraries that sequence the same reads repeatedly and other issues. In particular we expect the libraries to not be very complex; these are just tags of the end of a transcript and so for each transcript there are a limited number of positions where a read can be placed. We'll see how this feature skews some of the more commonly used quality metrics now.
For RNA-seq data many common issues can be detected right off the bat just by looking at some features of the raw reads. The most commonly used program to look at the raw reads is FastQC. FastQC is pretty fast, especially on small files, so we can run FastQC on one of the entire files. First lets copy one of those files over:
mkdir ~/workshop/fastq
cp /groups/pklab/scw2014/ES.MEF/fastq/L139_ESC_1.fq ~/workshop/fastq/
cd ~/workshop/fastq
Now we can run FastQC on the file by typing:
fastqc L139_ESC_1.fq
And look at the nice HTML report it generates with Firefox:
firefox L139_ESC_1_fastqc.html
This library looks pretty rough. The per base sequence quality plot shows some major quality problems during sequencing; having degrading quality as you sequence further is normal, but this is severe drop off. Severe quality drop off like this is generally due to a technical issue with the sequencer, it is possible it ran out or was running low on a reagent. The good news is it doesn't affect all of the reads, the median value still has a PHRED score > 20 (so 1 in 100 probability of an error), and most aligners can take into account the poor quality so this isn't as bad as it looks.
More worrying is the non-uniform per base sequence content plot. It depends on the genome, but for the mouse if you are randomly sampling from the transcriptome then you should expect there to be a pretty even distribution of GC-AT in each sequence with a slight GC/AT bias. We can see that is not the case at all, and the next plot, the per sequence GC content plot, has a huge GC spike in the middle. Usually you see plots like these when the overall complexity of the reads that are sequenced is low; by that we mean you have tended to sequence the same sample repeatedly.
That notion is reinforced looking at the duplication plot. If we de-duplicate the reads,
meaning remove reads where we have seen the same exact read twice, we'd throw out > 75%
of the data. It is also reinforced by the list of kmers that are more enriched than
would be expected by chance; a kmer is just every possible k length mer that is seen in
a sequence. For example all 3-mers of ACGT
are ACG CGT
. We'd expect all
of these features if we were sequencing the same sequences repeatedly.
One thing we would not expect, however, is the big uptick at the end of the kmer content plot; the sequences at the end look like some kind of adapter contamination issue. We'd expect these reads to not align unless we trimmed the adapter sequence off.
What are those sequences? We can search for the reads that have one of those enriched sequences with grep (*g*lobally search a *r*egular *e*xpression and *p*rint) which print out every line in a file that matches a search string. grep the L139_ESC_1.fq file like this:
grep TTGATATGGG L139_ESC_1.fq
You should see a lot of sequences that look like this:
AATTCGTGGAGAAAGAAATGGCTCGTCTGGCAGCATTTGATATGGG
If we BLAST this sequence in the mouse, we come up empty, so it is some kind of contaminant sequence, it isn't clear where it comes from. The protocol listed here doesn't have too many clues either. If we could figure out what these sequences are, it would help troubleshoot the preparation protocol and we might be able to align more reads. As it is, these sequences are unlikely to align to the mouse genome, so they mostly represent wasted sequencing.
For aligning RNA-seq reads it is necessary to use an aligner that is splicing aware; reads crossing splice junctions have gaps when aligned to the genome and the aligner has to be able to handle that possibility. There are a wide variety of aligners to choose from that handle spliced reads but the two most commonly used are Tophat and STAR. They both have similar accuracy but STAR is much, much faster than Tophat at the cost of using much more RAM; to align to the human genome you need ~ 40 GB of RAM, so it isn't something you will be able to run on your laptop or another type of RAM restricted computing environment. For this exercise we will use Tophat.
To align reads with Tophat you need three things.
First you must make an Bowtie2 index of the genome sequence; this allows the Tophat algorithm to quickly find regions of the genome where each read might align. We have done this step already, so don't type in these commands, but if you need to do it on your own, here is how to do it:
# don't type this in
bowtie2-build your_fasta_file genome_name
We've precomputed indexes for the mm10 genome here and downloaded a GTF file of Ensembl release 75 here:
/groups/bcbio/biodata/genomes/Mmusculus/mm10/bowtie2/
/groups/bcbio/biodata/genomes/Mmusculus/mm10/rnaseq/ref-transcripts.gtf
Finally we've precomputed an index of the gene sequences from the ref-transcripts.gtf
file here:
/groups/bcbio/biodata/genomes/Mmusculus/mm10/rnaseq/tophat/
We will use this precomputed index of the gene sequences instead of the GTF file because it is much faster; you can use either and they have the same output.
Now we're ready to align the reads to the mm10 genome. We will align two ESC samples and two MEF samples:
cd ~/workshop/subset
bsub -J L139_ESC_1 -W 00:20 -q short "tophat -o L139_ESC_1_tophat --no-coverage-search --transcriptome-index=/groups/bcbio/biodata/genomes/Mmusculus/mm10/rnaseq/tophat/mm10_transcriptome /groups/bcbio/biodata/genomes/Mmusculus/mm10/bowtie2/mm10 L139_ESC_1.subset.fastq; mv L139_ESC_1_tophat/accepted_hits.bam L139_ESC_1_tophat/L139_ESC_1.bam"
bsub -J L139_ESC_2 -W 00:20 -q short "tophat -o L139_ESC_2_tophat --no-coverage-search --transcriptome-index=/groups/bcbio/biodata/genomes/Mmusculus/mm10/rnaseq/tophat/mm10_transcriptome /groups/bcbio/biodata/genomes/Mmusculus/mm10/bowtie2/mm10 L139_ESC_2.subset.fastq; mv L139_ESC_2_tophat/accepted_hits.bam L139_ESC_2_tophat/L139_ESC_2.bam"
bsub -J L139_MEF_49 -W 00:20 -q short "tophat -o L139_MEF_49_tophat --no-coverage-search --transcriptome-index=/groups/bcbio/biodata/genomes/Mmusculus/mm10/rnaseq/tophat/mm10_transcriptome /groups/bcbio/biodata/genomes/Mmusculus/mm10/bowtie2/mm10 L139_MEF_49.subset.fastq; mv L139_MEF_49_tophat/accepted_hits.bam L139_MEF_49_tophat/L139_MEF_49.bam"
bsub -J L139_MEF_50 -W 00:20 -q short "tophat -o L139_MEF_50_tophat --no-coverage-search --transcriptome-index=/groups/bcbio/biodata/genomes/Mmusculus/mm10/rnaseq/tophat/mm10_transcriptome /groups/bcbio/biodata/genomes/Mmusculus/mm10/bowtie2/mm10 L139_MEF_50.subset.fastq; mv L139_MEF_50_tophat/accepted_hits.bam L139_MEF_50_tophat/L139_MEF_50.bam"
Each of these should complete in about ten minutes. Since we ran them all in parallel on
the cluster, the whole set should take about ten minutes instead of 40. Full samples would
take hours. -J
names the job so you can see what it is when you run bjobs
to
check the status of the jobs. -W 00:20
tells the scheduler the job should take about
20 minutes. -q short
submits the job to the short queue. At the end we tack on a command
to move the Tophat output filename accepted_hits.bam
to something more evocative.
This is fine for a small number of samples, but if you wanted to run a full set of hundreds of cells, doing this manually for every sample is a waste of time and prone to errors. You can run all of these automatically by writing a loop:
# don't type this in, it is here for future reference
for file in *.fastq; do
samplename=`basename $file .fastq`
bsub -W 00:20 -q short "tophat -o $samplename_tophat --no-coverage-search --transcriptome-index=/groups/bcbio/biodata/genomes/Mmusculus/mm10/rnaseq/tophat/mm10_transcriptome /groups/bcbio/biodata/genomes/Mmusculus/mm10/bowtie2/mm10 $file; mv $samplename_tophat/accepted_hits.bam $samplename_tophat/$samplename.bam
done
This will loop over all of the files with a .fastq extension in the current directory and align them with Tophat. We'll skip ahead now to doing some quality control of the alignments and finally counting the reads mapping to each feature.
There are several tools to spot check the alignments, it is common to run RNA-SeQC on the alignment files to generate some alignment stats and to determine the overall coverage, how many genes were detected and so on. Another option for a suite of quality checking tools is RSeQC. For real experiments it is worth it to look at the output of these tools and see if anything seems amiss.
The last step is to count the number of reads mapping to the features are are interested in. Quantitation can be done at multiple levels; from the level of counting the number of reads supporting a specific splicing event, to the number of reads aligning to an isoform of a gene or the total reads mapping to a known gene. We'll be quantitating the latter, the total number of reads that can uniquely be assigned to a gene. There are several tools to do this, we will use featureCounts because it is very fast and accurate.
featureCounts --primary -a /groups/bcbio/biodata/genomes/Mmusculus/mm10/rnaseq/ref-transcripts.gtf -o combined.featureCounts L139_ESC_1_tophat/L139_ESC_1.bam L139_ESC_2_tophat/L139_ESC_2.bam L139_MEF_49_tophat/L139_MEF_49.bam L139_MEF_50_tophat/L139_MEF_50.bam
--primary
tells featureCounts to only count the primary alignment for reads that
map multiple times to the genome. This ensures we do not double count reads that map to
multiple places in the genome.
We need to massage the format of this file so we can use it. We'll take the first column, which is the gene ids and every column after the 6th, which has the counts of each sample.
sed 1d combined.featureCounts | cut -f1,7- | sed s/Geneid/id/ > combined.counts
This command means steam edit (sed) the file combined.featureCounts, delete the first line,
keep the first column and everything the 7th column on and change the phrase Geneid
to id
. This outputs a file in a format with I rows of genes and the J columns of samples.
Each cell is the number of reads that can be uniquely assigned to the gene i the sample
j. This file is of suitable format for loading into R.